bio rad gene pulser xcell electroporation system (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
97
Structured Review
Bio-Rad
bio rad gene pulser xcell electroporation system
Bio Rad Gene Pulser Xcell Electroporation System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 5935 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+pulser+electroporation+system/Gene+Pulser+Xcell+Total+System/pmc12811641-358-13-13
Average 97 stars, based on 5935 article reviews
Bio Rad Gene Pulser Xcell Electroporation System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 5935 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gene+pulser+electroporation+system/Gene+Pulser+Xcell+Total+System/pmc12811641-358-13-13
Average 97 stars, based on 5935 article reviews
bio rad gene pulser xcell electroporation system - by Bioz Stars,
2026-10
97/100 stars
Images
Related Articles
Negative Control:Article Title: Improvement of carboplatin chemosensitivity in lung cancer cells by siRNA-mediated downregulation of DLGAP1-AS2 expression Article Snippet: .. To optimize the dosage of siRNA, scramble siRNA (negative control, 5’ UUCUCCGAACGUGUCACGUUU 3’) and siRNA-DLGAP1-AS2 (Table ) were transfected separately into A549 cells at varying doses (10, 20, and 40 pmol) using a Article Title: Improvement of carboplatin chemosensitivity in lung cancer cells by siRNA-mediated downregulation of DLGAP1-AS2 expression. Article Snippet: To detach the cells, 0.25% Trypsin/EDTA from Gibco was used, and trypsin activity was subsequently neutralized in complete medium containing 10% FBS. .. After being subcultured three times to achieve the logarithmic growth phase, characterized by clear cell morphology and stable cell function, the cell lines were ready for further experimentation. siRNA transfection To optimize the dosage of siRNA, scramble siRNA (negative control, 5’ U U C U C C G A A C G U G U C A C G U U U 3’) and siRNA-DLGAP1-AS2 (Table 1) were transfected separately into A549 cells at varying doses (10, 20, and 40 pmol) using a Transfection:Article Title: Improvement of carboplatin chemosensitivity in lung cancer cells by siRNA-mediated downregulation of DLGAP1-AS2 expression Article Snippet: .. To optimize the dosage of siRNA, scramble siRNA (negative control, 5’ UUCUCCGAACGUGUCACGUUU 3’) and siRNA-DLGAP1-AS2 (Table ) were transfected separately into A549 cells at varying doses (10, 20, and 40 pmol) using a Article Title: Improvement of carboplatin chemosensitivity in lung cancer cells by siRNA-mediated downregulation of DLGAP1-AS2 expression. Article Snippet: To detach the cells, 0.25% Trypsin/EDTA from Gibco was used, and trypsin activity was subsequently neutralized in complete medium containing 10% FBS. .. After being subcultured three times to achieve the logarithmic growth phase, characterized by clear cell morphology and stable cell function, the cell lines were ready for further experimentation. siRNA transfection To optimize the dosage of siRNA, scramble siRNA (negative control, 5’ U U C U C C G A A C G U G U C A C G U U U 3’) and siRNA-DLGAP1-AS2 (Table 1) were transfected separately into A549 cells at varying doses (10, 20, and 40 pmol) using a Article Title: Immediate early splicing controls translation in activated T-cells and is mediated by hnRNPC2 phosphorylation Article Snippet: Transfections of HEK293 and HeLa cells using either ROTIFect (Carl Roth) or Lipofectamine 2000, respectively were performed according to the manufacturer’s instructions. .. Transfections of Jurkat cells were performed using a Electroporation:Article Title: Improvement of carboplatin chemosensitivity in lung cancer cells by siRNA-mediated downregulation of DLGAP1-AS2 expression Article Snippet: .. To optimize the dosage of siRNA, scramble siRNA (negative control, 5’ UUCUCCGAACGUGUCACGUUU 3’) and siRNA-DLGAP1-AS2 (Table ) were transfected separately into A549 cells at varying doses (10, 20, and 40 pmol) using a Article Title: Heterogeneity of iridoid biosynthesis in catmints: Molecular background in a phylogenetic context Article Snippet: .. Agrobacterium tumefaciens strain LBA4404 was transformed with 300 ng of plasmid DNA using the electroporation method with the Article Title: The role of PD-L1 gene silencing on growth, migration, and apoptosis in oral squamous carcinoma cell line HN-5 Article Snippet: .. A Article Title: Improvement of carboplatin chemosensitivity in lung cancer cells by siRNA-mediated downregulation of DLGAP1-AS2 expression. Article Snippet: To detach the cells, 0.25% Trypsin/EDTA from Gibco was used, and trypsin activity was subsequently neutralized in complete medium containing 10% FBS. .. After being subcultured three times to achieve the logarithmic growth phase, characterized by clear cell morphology and stable cell function, the cell lines were ready for further experimentation. siRNA transfection To optimize the dosage of siRNA, scramble siRNA (negative control, 5’ U U C U C C G A A C G U G U C A C G U U U 3’) and siRNA-DLGAP1-AS2 (Table 1) were transfected separately into A549 cells at varying doses (10, 20, and 40 pmol) using a Article Title: Plasticity in a bacterial global regulatory switch that drives a shift in antibiotic resistance and virulence Article Snippet: .. Electrocompetent PA cells were prepared by washing in 300 mM sucrose and transformation with the constructs was performed using a Article Title: Immediate early splicing controls translation in activated T-cells and is mediated by hnRNPC2 phosphorylation Article Snippet: Transfections of HEK293 and HeLa cells using either ROTIFect (Carl Roth) or Lipofectamine 2000, respectively were performed according to the manufacturer’s instructions. .. Transfections of Jurkat cells were performed using a other:Article Title: Immediate early splicing controls translation in activated T-cells and is mediated by hnRNPC2 phosphorylation. Article Snippet: Events were then clustered into bins centred between −0.15 and −0.65 (in 0.05 steps) using GraphPad Prism. Article Title: Heterogeneity of iridoid biosynthesis in catmints: Molecular background in a phylogenetic context. Article Snippet: Reconstitution of nepetalactone production in chemotype B N. grandiflora leaves Cloning Coding sequences for NrNEPS1, identified in the N. rtanjensis transcriptome (Aničić et al., 2020), and NcNEPS5 from N. cataria (Lichman et al., 2020) were assembled into expression constructs using the Modular Cloning (MoClo) toolkit (Addgene, Watertown, MA, USA) and the Plant MoClo toolkit (Weber et al., 2011; Engler et al., 2014). Transformation Assay:Article Title: Heterogeneity of iridoid biosynthesis in catmints: Molecular background in a phylogenetic context Article Snippet: .. Agrobacterium tumefaciens strain LBA4404 was transformed with 300 ng of plasmid DNA using the electroporation method with the Article Title: Plasticity in a bacterial global regulatory switch that drives a shift in antibiotic resistance and virulence Article Snippet: .. Electrocompetent PA cells were prepared by washing in 300 mM sucrose and transformation with the constructs was performed using a Plasmid Preparation:Article Title: Heterogeneity of iridoid biosynthesis in catmints: Molecular background in a phylogenetic context Article Snippet: .. Agrobacterium tumefaciens strain LBA4404 was transformed with 300 ng of plasmid DNA using the electroporation method with the Article Title: Plasticity in a bacterial global regulatory switch that drives a shift in antibiotic resistance and virulence Article Snippet: .. Electrocompetent PA cells were prepared by washing in 300 mM sucrose and transformation with the constructs was performed using a Transferring:Article Title: The role of PD-L1 gene silencing on growth, migration, and apoptosis in oral squamous carcinoma cell line HN-5 Article Snippet: .. A Incubation:Article Title: The role of PD-L1 gene silencing on growth, migration, and apoptosis in oral squamous carcinoma cell line HN-5 Article Snippet: .. A Stable Transfection:Article Title: Improvement of carboplatin chemosensitivity in lung cancer cells by siRNA-mediated downregulation of DLGAP1-AS2 expression. Article Snippet: To detach the cells, 0.25% Trypsin/EDTA from Gibco was used, and trypsin activity was subsequently neutralized in complete medium containing 10% FBS. .. After being subcultured three times to achieve the logarithmic growth phase, characterized by clear cell morphology and stable cell function, the cell lines were ready for further experimentation. siRNA transfection To optimize the dosage of siRNA, scramble siRNA (negative control, 5’ U U C U C C G A A C G U G U C A C G U U U 3’) and siRNA-DLGAP1-AS2 (Table 1) were transfected separately into A549 cells at varying doses (10, 20, and 40 pmol) using a Construct:Article Title: Plasticity in a bacterial global regulatory switch that drives a shift in antibiotic resistance and virulence Article Snippet: .. Electrocompetent PA cells were prepared by washing in 300 mM sucrose and transformation with the constructs was performed using a |
